Detail Information of mm0000704
1.Basic Information

Name: mm0000704
Species: Mus musculus
Cell Line: RAW 264.7
Restriction Enzyme: XbaI

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
PU.1,the upstream regulatory element NA NA NA
Target
Locus2 Fragment location Primer sequence Strand
PU.1,intron 3,intronic element 11:47407082-47413702 ACCAGCCCCACCCAGGCTGGTGTC -

4.Reference

Ebralidze, A. K., et al. (2008). "PU.1 expression is modulated by the balance of functional sense and antisense RNAs regulated by a shared cis-regulatory element." Genes Dev 22(15): 2085-2092.   PMID: 18676813

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.