Detail Information of mm0000681 [Genome Browser]
1.Basic Information

Name: mm0000681
Species: Mus musculus
Cell Line: P3X
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Ciita,promoter,segmnet pIII 16:10487676-10488739 TTCAGGGTTGTGGTGGTAGG -
Target
Locus2 Fragment location Primer sequence Strand
Ciitadistinct promoter ,segment pI 16:10477806-10480527 TGAGCCTGATGGTGATGC +

4.Reference

Yoon, H. and J. M. Boss (2010). "PU.1 binds to a distal regulatory element that is necessary for B cell-specific expression of CIITA." J Immunol 184(9): 5018-5028.   PMID: 20363966

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.