Detail Information of mm0000663 [Genome Browser]
1.Basic Information

Name: mm0000663
Species: Mus musculus
Cell Line: ES cells
Restriction Enzyme: MspI

2.Experiment Infromation

Remark: increased cross-linking frequencies in EBs than ES cells
Primer amount: 14
Test repetition: two to thr
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Eomes,enhancer 9:118470129-118470968 CTCACGGGTCTAAGCAAGCATGATGGCTCAT +
Target
Locus2 Fragment location Primer sequence Strand
Eomes,promoter 9:118477056-118477486 GAGGGAATTCTGAGTAATGAAAGTG +

4.Reference

Kartikasari, A. E., et al. (2013). "The histone demethylase Jmjd3 sequentially associates with the transcription factors Tbx3 and Eomes to drive endoderm differentiation." EMBO J 32(10): 1393-1408.   PMID: 23584530

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.