Detail Information of mm0000659 [Genome Browser]
1.Basic Information

Name: mm0000659
Species: Mus musculus
Cell Line: MC3T3-E1
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: d0 & d9 cultures
Primer amount: 40
Test repetition: NA
Reliability Level: IV

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Runx2, promoter,segment P1 17:44813514-44815624 TTTTATTACGTGGCGGCTCTTACAATAAAG +
Target
Locus2 Fragment location Primer sequence Strand
Runx2, promoter,segment P2 17:44725985-44736407 GGCCCCCCTCGCGTTTCAAGGTGCCGGG +

4.Reference

Barutcu, A. R., et al. (2014). "The bone-specific Runx2-P1 promoter displays conserved three-dimensional chromatin structure with the syntenic Supt3h promoter." Nucleic Acids Res 42(16): 10360-10372.   PMID: 25120271

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.