Detail Information of mm0000625 [Genome Browser]
1.Basic Information

Name: mm0000625
Species: Mus musculus
Cell Line: MEL
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: 3C-qPCR;control: fetal brain (FB E12.5)
Primer amount: 16
Test repetition: at least t
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Myb,promoter 10:21160066-21164995 TCAAACATAGCTCAGAAAGCTT +
Target
Locus2 Fragment location Primer sequence Strand
Myb,-68kb segment 10:21227602-21230648 AGCAGGCTATTGTGAAAAGAGG -

4.Reference

Stadhouders, R., et al. (2012). "Dynamic long-range chromatin interactions control Myb proto-oncogene transcription during erythroid development." EMBO J 31(4): 986-999.   PMID: 22157820

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.