Detail Information of hs0000154 [Genome Browser]
1.Basic Information

Name: hs0000154
Species: Homo sapiens
Cell Line: HuT-78
Restriction Enzyme: NmuCI

2.Experiment Infromation

Remark: GATA3 and NFAT binds
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
IL4,promoter,segment A 5:132009578-132009723 AAACTCATTTTCCCTCGGTTTC +
Target
Locus2 Fragment location Primer sequence Strand
IL13,promoter,segment D 5:131993461-131993572 CACCAGAAGTGCTGAGCAGATA -

4.Reference

Yao, X., et al. (2012). "Coordinated regulation of IL-4 and IL-13 expression in human T cells: 3C analysis for DNA looping." Biochem Biophys Res Commun 417(3): 996-1001.   PMID: 22226971

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.