Detail Information of mm0000604 [Genome Browser]
1.Basic Information

Name: mm0000604
Species: Mus musculus
Cell Line: B cells
Restriction Enzyme: AseI

2.Experiment Infromation

Remark: control: LPS,NF-κB; LPS treatment;require activation of NF-κB
Primer amount: NA
Test repetition: three
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
IgK4J1,IgK4J5,enhancer,E3' 6:70733712-70740792 AGAAGCAGAACTGTCTAGAGACT +
Target
Locus2 Fragment location Primer sequence Strand
IgK4J1,IgK4J5,Ed 6:70740787-70746398 CAGAAATAAGAAACTGCCCACGG +

4.Reference

Liu, Z., et al. (2009). "Divergent roles of RelA and c-Rel in establishing chromosomal loops upon activation of the Igkappa gene." J Immunol 183(6): 3819-3830.   PMID: 19710460

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.