Detail Information of mm0000596 [Genome Browser]
1.Basic Information

Name: mm0000596
Species: Mus musculus
Cell Line: Hepa-1c1c7
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: absent in AtT20 cells; not dependent on the presence of hormone
Primer amount: NA
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Lcn2,glucocorticoid-responsive element 2:32385222-32389197 TTTACCTGTTTGCTGCTCCT +
Target
Locus2 Fragment location Primer sequence Strand
Ciz1,-26 kb segment 2:32363704-32365185 TGAAAACAAACAAACAAATCCAAGCG +

4.Reference

Bhattacharya, A., et al. (2012). "Upstream distal regulatory elements contact the Lmo2 promoter in mouse erythroid cells." PLoS One 7(12): e52880.   PMID: 23285212

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.