Detail Information of mm0000572 [Genome Browser]
1.Basic Information

Name: mm0000572
Species: Mus musculus
Cell Line: liver cells
Restriction Enzyme: NcoI

2.Experiment Infromation

Remark: not in brain; peak and control in brain
Primer amount: NA
Test repetition: NA
Reliability Level: IV

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Hba-a2,segment XVII 11:32280779-32282977 TGGAGGATGCGGCAGTTAGTG -
Target
Locus2 Fragment location Primer sequence Strand
Hba,HS26,segment VIII 11:32250517-32252006 TCATAATAGGTGGGTGGAATCAG -

4.Reference

Zhou, G. L., et al. (2006). "Active chromatin hub of the mouse alpha-globin locus forms in a transcription factory of clustered housekeeping genes." Mol Cell Biol 26(13): 5096-5105.   PMID: 16782894

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.