Detail Information of mm0000566 [Genome Browser]
1.Basic Information

Name: mm0000566
Species: Mus musculus
Cell Line: chondrocytes
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: conrol: treatment, nearby locus, no cross-linking; IL-1β-stimulation dependent;RelA or c-Jun or Lef1 knockdown decreased the formation of gene loop
Primer amount: NA
Test repetition: three
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Mmp13,5' end,segment A 9:7271262-7273712 CCAGGAGCAGGTTAATAGATCTGTTG -
Target
Locus2 Fragment location Primer sequence Strand
Mmp13,3' end,segment D 9:7277565-7281152 TTCCCTGGAATTGGCAACAAAGTAGA +

4.Reference

Yun, K., et al. (2009). "Lymphoid enhancer binding factor 1 regulates transcription through gene looping." J Immunol 183(8): 5129-5137.   PMID: 19783677

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.