Detail Information of mm0000549 [Genome Browser]
1.Basic Information

Name: mm0000549
Species: Mus musculus
Cell Line: muscle cells
Restriction Enzyme: BamHI & BglII

2.Experiment Infromation

Remark: only on the active paternal chromosome,CTCF bind to ICR(only maternal)- ICR(a insulator) interact with Igf-block interaction between lgf2 and enhancers-H19 interact with enhancer
Primer amount: NA
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Igf2,promoter,segment 1 7:142661340-142663939 GTGAACAGAACAAATGCTGACCGA +
Target
Locus2 Fragment location Primer sequence Strand
H19,mesodermal enhancer 7:142548610-142550711 CCTAATGAGCTGTTTCCAAGCCCTTTGAT -

4.Reference

Yoon, Y. S., et al. (2007). "Analysis of the H19ICR insulator." Mol Cell Biol 27(9): 3499-3510.   PMID: 17339341

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.