Detail Information of mm0000544 [Genome Browser]
1.Basic Information

Name: mm0000544
Species: Mus musculus
Cell Line: ES cells
Restriction Enzyme: BamHI

2.Experiment Infromation

Remark: p3.7 female cell line;d4 begin to have interaction
Primer amount: NA
Test repetition: at least t
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Tsix,segment 3 X:103451962-103460262 CTAACAAGTGTGAGCCACCTGCC -
Target
Locus2 Fragment location Primer sequence Strand
Neo F3,segment N3 11:50344800-50345928 ACGTTGTCACTGAAGCGGGAAGGG -

4.Reference

Xu, N., et al. (2006). "Transient homologous chromosome pairing marks the onset of X inactivation." Science 311(5764): 1149-1152.   PMID: 16424298

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.