Detail Information of mm0000534 [Genome Browser]
1.Basic Information

Name: mm0000534
Species: Mus musculus
Cell Line: NA
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: In the absence of HS -40, not affect
Primer amount: NA
Test repetition: three
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Hba 11:32295040-32298461 GTGGCCATGAGCCAAAGAAT -
Target
Locus2 Fragment location Primer sequence Strand
Hba,HS-26 11:32249816-32254742 GAATCTCCATCTCCAAGGG -

4.Reference

Vernimmen, D., et al. (2009). "Chromosome looping at the human alpha-globin locus is mediated via the major upstream regulatory element (HS -40)." Blood 114(19): 4253-4260.   PMID: 19696202

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.