Detail Information of hs0000146 [Genome Browser]
1.Basic Information

Name: hs0000146
Species: Homo sapiens
Cell Line: LS 180
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: at least t
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
MUC2,promoter 11:1067226-1073253 CTGCCTGTAACCTCAGAC +
Target
Locus2 Fragment location Primer sequence Strand
AP2A2,3'end 14:90080592-90093793 ATGAATGAATGAATGAACGACAG -

4.Reference

Gosalia, N., et al. (2013). "Coordinate regulation of the gel-forming mucin genes at chromosome 11p15.5." Journal of Biological Chemistry 288(9): 6717-6725.   PMID: 23303185

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.