Detail Information of mm0000518 [Genome Browser]
1.Basic Information

Name: mm0000518
Species: Mus musculus
Cell Line: T cells
Restriction Enzyme: BstYI

2.Experiment Infromation

Remark: (P+I)-stimulated;a negative control of theGapd gene
Primer amount: NA
Test repetition: at least t
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Tnf,promoter,segment C 17:35201426-35202957 TCTCCCAATCCGTATGACTC +
Target
Locus2 Fragment location Primer sequence Strand
Tnf,HSS+3,segment E 17:35195526-35199305 CGTGATCTCTAGGTCGGAGA -

4.Reference

Tsytsykova, A. V., et al. (2007). "Activation-dependent intrachromosomal interactions formed by the TNF gene promoter and two distal enhancers." Proc Natl Acad Sci USA 104(43): 16850-16855.   PMID: 17940009

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.