Detail Information of mm0000490 [Genome Browser]
1.Basic Information

Name: mm0000490
Species: Mus musculus
Cell Line: 3T3-L1
Restriction Enzyme: StuI/PvuII

2.Experiment Infromation

Remark: lower in C3H10T1/2 cells(6h is the strongest)
Primer amount: NA
Test repetition: three
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Pparg,promoter 6:115421164-115421934 GTAATGTACCAAGTCTTGCCAAAGCAGCAG +
Target
Locus2 Fragment location Primer sequence Strand
Adipoq,promoter 16:23145434-23146480 TAGAGAATGGCCAAAGCCTGGAAACAGGA +

4.Reference

LeBlanc, S. E., et al. (2014). "The PPARgamma locus makes long-range chromatin interactions with selected tissue-specific gene loci during adipocyte differentiation in a protein kinase A dependent manner." PLoS One 9(1): e86140.   PMID: 24465921

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.