Detail Information of hs0000141 [Genome Browser]
1.Basic Information

Name: hs0000141
Species: Homo sapiens
Cell Line: HEK293T
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: TNF-aphla-induced;NF-kappaB,p50 binding to promoter
Primer amount: NA
Test repetition: three
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
CRP,promoter 1:159684366-159687081 CTGTCCCACCACTCTCTATCTGA +
Target
Locus2 Fragment location Primer sequence Strand
CRP,upstream segment 4 1:159697373-159698092 AGCAAAAGAGCAAAGGGAGA +

4.Reference

Choi, Y. S., et al. (2007). "Beta-catenin binds to the downstream region and regulates the expression C-reactive protein gene." Nucleic Acids Res 35(16): 5511-5519.   PMID: 17704137

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.