Detail Information of mm0000480 [Genome Browser]
1.Basic Information

Name: mm0000480
Species: Mus musculus
Cell Line: limb
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: NA
Primer amount: 11
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Wnt7a,promoter 6:91418208-91418570 TCTTAAGAGACAATAAAACACAAGAAA -
Target
Locus2 Fragment location Primer sequence Strand
Wnt7a,segment 3 6:91285871-91297036 ATCTGGGAGTGATCCAGGTTT -

4.Reference

DeMare, L. E., et al. (2013). "The genomic landscape of cohesin-associated chromatin interactions." Genome Res 23(8): 1224-1234.   PMID: 23704192

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.