Detail Information of mm0000437 [Genome Browser]
1.Basic Information

Name: mm0000437
Species: Mus musculus
Cell Line: T cells
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: IV

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Tcra,enhancer,segment Eα 14:54222279-54228944 AAGTCAAGGCACAGACAGTC +
Target
Locus2 Fragment location Primer sequence Strand
TEA,promoter,segment 3 14:54149104-54149797 GTCCCTCTGTGTAAGGATGG +

4.Reference

Shih, H. Y., et al. (2012). "Tcra gene recombination is supported by a Tcra enhancer- and CTCF-dependent chromatin hub." Proc Natl Acad Sci USA 109(50): E3493-3502.   PMID: 23169622

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.