Detail Information of hs0000136 [Genome Browser]
1.Basic Information

Name: hs0000136
Species: Homo sapiens
Cell Line: PC-3
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: control: LNCaP cells; treatment: DHT;FoxA1 and MED1 mediated interactions
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
UBE2C,promoter 20:44434945-44441546 TAGGCATTGGTACCCAGAGCA +
Target
Locus2 Fragment location Primer sequence Strand
UBE2C,+14 kb enhancer 2 20:44425076-44427350 CCTGGGGTACTCTACCCTTAACTC +

4.Reference

Chen, Z., et al. (2011). "Phospho-MED1-enhanced UBE2C locus looping drives castration-resistant prostate cancer growth." EMBO J 30(12): 2405-2419.   PMID: 21556051

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.