Detail Information of mm0000422 [Genome Browser]
1.Basic Information

Name: mm0000422
Species: Mus musculus
Cell Line: myocyte
Restriction Enzyme: BamHI/BglII

2.Experiment Infromation

Remark: NA
Primer amount: 8
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Nctc1,mesoderm enhancer 7:142548610-142553881 ATCTTGGGATCATGCAGAGAG +
Target
Locus2 Fragment location Primer sequence Strand
H19,promoter 7:142568511-142580161 CAGGTGGAAAGAGCTCTTAGAGA -

4.Reference

Eun, B., et al. (2013). "Promoter cross-talk via a shared enhancer explains paternally biased expression of Nctc1 at the Igf2/H19/Nctc1 imprinted locus." Nucleic Acids Res 41(2): 817-826.   PMID: 23221643

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.