Detail Information of mm0000409 [Genome Browser]
1.Basic Information

Name: mm0000409
Species: Mus musculus
Cell Line: Rod cells
Restriction Enzyme: BpmI

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: three
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Gnat1,promoter 14:33950458-33952392 TCCTGGTAGTCTTCACCCTCTCC +
Target
Locus2 Fragment location Primer sequence Strand
Gnat1,segment E8 9:107675678-107676031 GAGGTTCTCCTTGATGATAATGTC +

4.Reference

Peng, G. H. and S. Chen (2011). "Active opsin loci adopt intrachromosomal loops that depend on the photoreceptor transcription factor network." Proc Natl Acad Sci USA 108(43): 17821-17826.   PMID: 22006320

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.