Detail Information of hs0000132 [Genome Browser]
1.Basic Information

Name: hs0000132
Species: Homo sapiens
Cell Line: CD4+ T cells
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: highly
Primer amount: 11
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
ASS1,segment P4 9:133333050-133336509 GTGTGTATGCTGCCATCTGTG +
Target
Locus2 Fragment location Primer sequence Strand
PRDM12,segment P1 9:133541717-133558030 GAGGCACAATGGAAATCCTCT +

4.Reference

Chepelev, I., et al. (2012). "Characterization of genome-wide enhancer-promoter interactions reveals co-expression of interacting genes and modes of higher order chromatin organization." Cell Res 22(3): 490-503.   PMID: 22270183

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.