Detail Information of mm0000385 [Genome Browser]
1.Basic Information

Name: mm0000385
Species: Mus musculus
Cell Line: brain cells
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: four
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Irx3,LD-block 8:91374113-91375793 TGGTCTCGGGTATCTTGTCC +
Target
Locus2 Fragment location Primer sequence Strand
Irx3,promoter 8:91798171-91804283 TGATGTTGGTTCCTTACTAGG -

4.Reference

Smemo, S., et al. (2014). "Obesity-associated variants within FTO form long-range functional connections with IRX3." Nature 507(7492): 371-375.   PMID: 24646999

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.