Detail Information of mm0000384 [Genome Browser]
1.Basic Information

Name: mm0000384
Species: Mus musculus
Cell Line: C2C12
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: NA
Primer amount: 13
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Hes1,promoter,CRM 16:30057629-30066665 TGGTTTAGCACCGGTCCAA +
Target
Locus2 Fragment location Primer sequence Strand
Hes1,CRM7,segment primer12 16:29998965-30006757 ATCTAACCCTAACGTAACAGTATTCG +

4.Reference

Jeziorska, D. M., et al. (2012). "Novel cis-regulatory modules control expression of the Hairy and Enhancer of Split-1 (HES1) transcription factor in myoblasts." Journal of Biological Chemistry 287(8): 5687-5697.   PMID: 22167192

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.