Detail Information of mm0000379 [Genome Browser]
1.Basic Information

Name: mm0000379
Species: Mus musculus
Cell Line: heart
Restriction Enzyme: BamHI

2.Experiment Infromation

Remark: NA
Primer amount: 5
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Nppa,promoter 4:147980492-147986496 CTTATATATGCAATGGTGTCAGCACTT -
Target
Locus2 Fragment location Primer sequence Strand
Nappa,CR9 4:147962107-147964212 CCATCTTGGAACCTGGTGGTT +

4.Reference

Matsuoka, K., et al. (2014). "Noninvasive and quantitative live imaging reveals a potential stress-responsive enhancer in the failing heart." FASEB J 28(4): 1870-1879.   PMID: 24391132

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.