Detail Information of mm0000373 [Genome Browser]
1.Basic Information

Name: mm0000373
Species: Mus musculus
Cell Line: RAW 264.7
Restriction Enzyme: PstI

2.Experiment Infromation

Remark: LPS stimulation; AP-1 and NF-kB binding sites
Primer amount: 4
Test repetition: three
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Spp1,promoter,segment A 5:104433258-104433759 AGGCAGCAAGCCGTCCA NA
Target
Locus2 Fragment location Primer sequence Strand
Spp1,promoter,segment B 5:104433258-104433759 AACACATCTATCAAGAGATAACCCAA +

4.Reference

Zhao, W., et al. (2011). "NF-kappaB- and AP-1-mediated DNA looping regulates osteopontin transcription in endotoxin-stimulated murine macrophages." J Immunol 186(5): 3173-3179.   PMID: 21257959

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.