Detail Information of mm0000368 [Genome Browser]
1.Basic Information

Name: mm0000368
Species: Mus musculus
Cell Line: myoblasts
Restriction Enzyme: BamHI

2.Experiment Infromation

Remark: strongly downregulated in Myod-/- myoblasts
Primer amount: 24
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Cdcs9,mesodermal enhancer 7:142550706-142552608 CCGTCCTTTGGGCATAGCTTCC -
Target
Locus2 Fragment location Primer sequence Strand
H19,promoter 7:142650982-142653325 GGCCCTCCATCTTGTCTCTTCC -

4.Reference

Borensztein, M., et al. (2013). "Myod and H19-Igf2 locus interactions are required for diaphragm formation in the mouse." Development 140(6): 1231-1239.   PMID: 23406902

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.