Detail Information of mm0000360 [Genome Browser]
1.Basic Information

Name: mm0000360
Species: Mus musculus
Cell Line: chondrocytes
Restriction Enzyme: PstI

2.Experiment Infromation

Remark: Lef1 binding site
Primer amount: 9
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Col2a1,promoter,segment primer A 15:98004035-98005404 CACAGACGCATCACCTTCCACCAGC -
Target
Locus2 Fragment location Primer sequence Strand
Col2a1,3' UTR,segment primer F 15:97973725-97977375 GCAAGTCTCGCCGGTCTCCATGTTGCAG +

4.Reference

Jash, A., et al. (2012). "Looping mediated interaction between the promoter and 3' UTR regulates type II collagen expression in chondrocytes." PLoS One 7(7): e40828.   PMID: 22815835

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.