Detail Information of mm0000359 [Genome Browser]
1.Basic Information

Name: mm0000359
Species: Mus musculus
Cell Line: MBW2
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Kcnq1,promoter,segment R2 7:143103680-143105205 CCAGGTTGGCCTTGAACTTACTATGTCG +
Target
Locus2 Fragment location Primer sequence Strand
Kcnq1,DMR1,segment R4 7:143290541-143295092 GGTTAAGAACCCACTGCAACCACTGCGG +

4.Reference

Zhang, H., et al. (2014). "Long noncoding RNA-mediated intrachromosomal interactions promote imprinting at the Kcnq1 locus." J Cell Biol 204(1): 61-75.   PMID: 24395636

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.