Detail Information of mm0000353
1.Basic Information

Name: mm0000353
Species: Mus musculus
Cell Line: MPC-11
Restriction Enzyme: NspI

2.Experiment Infromation

Remark: not on peaks,p65NF- B, E47, and AP-4 are potential candidates;NF- B is not responsible for maintenance of interactions
Primer amount: NA
Test repetition: three
Reliability Level: NA

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
IgK V,enhancer 2, segment Ed 6:70742263-70744849 TGTCAGCTTGCCAAGTAGAC -
Target
Locus2 Fragment location Primer sequence Strand
immunoglobulin kappa V gene kappa 21-5 region NA ACAGACACACTCCTGCTATA NA

4.Reference

Liu, Z. and W. T. Garrard (2005). "Long-range interactions between three transcriptional enhancers, active Vkappa gene promoters, and a 3' boundary sequence spanning 46 kilobases." Mol Cell Biol 25(8): 3220-3231.   PMID: 15798207

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.