Detail Information of mm0000332 [Genome Browser]
1.Basic Information

Name: mm0000332
Species: Mus musculus
Cell Line: liver cells
Restriction Enzyme: MboI

2.Experiment Infromation

Remark: control: treatment; not dependent on activation of FXR(farnesoid X receptor)
Primer amount: NA
Test repetition: three
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Nr0b2,proximal promoter, IR1(inverted repeat) 4:133552734-133553683 TAGCCAAGACAGTAGCCTTCCTCA +
Target
Locus2 Fragment location Primer sequence Strand
Nr0b2 proximal promoter,+3640 bp segment 4:133556997-133557123 TCCTGAGTTCAAATTCCGGCAACC -

4.Reference

Li, G., et al. (2010). "Farnesoid X receptor activation mediates head-to-tail chromatin looping in the Nr0b2 gene encoding small heterodimer partner." Mol Endocrinol 24(7): 1404-1412.   PMID: 20444884

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.