Detail Information of mm0000294 [Genome Browser]
1.Basic Information

Name: mm0000294
Species: Mus musculus
Cell Line: G1E
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: β-estradiol-treated (48 h) G1E-ER-GATA-1 cells, 37°C; increased 5-fold upon ER-GATA-1 activation only at 37°C
Primer amount: NA
Test repetition: three
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Hbb-b1 promoter 7:103825137-103830556 GGTGGAAGGGGGTATTATGAACATTCGG +
Target
Locus2 Fragment location Primer sequence Strand
β-globin locus LCR HS2 7:103852510-103861236 ATGACTCAGCACTGCTGTGCTCAAGCC +

4.Reference

Kim, S. I., et al. (2007). "Dissecting molecular steps in chromatin domain activation during hematopoietic differentiation." Mol Cell Biol 27(12): 4551-4565.   PMID: 17438135

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.