Detail Information of mm0000290 [Genome Browser]
1.Basic Information

Name: mm0000290
Species: Mus musculus
Cell Line: G1E
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: GATA-2+/GATA-1-represents parental G1E
Primer amount: NA
Test repetition: five
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Kit,+5kb segment 5:75576519-75580064 AGCCTCAAGTCTAGTTGGGCGGTATTAGCAG +
Target
Locus2 Fragment location Primer sequence Strand
Kit,-114kb segment 5:75459207-75465659 AACACAGGACCATTTCAGGATGAGCACTGG -

4.Reference

Jing, H., et al. (2008). "Exchange of GATA factors mediates transitions in looped chromatin organization at a developmentally regulated gene locus." Mol Cell 29(2): 232-242.   PMID: 18243117

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.