Detail Information of mm0000289 [Genome Browser]
1.Basic Information

Name: mm0000289
Species: Mus musculus
Cell Line: forebrain
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: IV

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Grin2b,TSS 6:136168212-136173676 CAATGGCTACCTTTGAGAGAGACACG -
Target
Locus2 Fragment location Primer sequence Strand
Grin2b,intron 3,+30kb segment primer 10 6:136144815-136145795 CCCACCATGAAGTAATGTCCTGTCTC -

4.Reference

Jiang, Y., et al. (2010). "Setdb1 histone methyltransferase regulates mood-related behaviors and expression of the NMDA receptor subunit NR2B." J Neurosci 30(21): 7152-7167.   PMID: 20505083

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.