Detail Information of mm0000287 [Genome Browser]
1.Basic Information

Name: mm0000287
Species: Mus musculus
Cell Line: MEF cells
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Plagl1,DMR,-4 kb segment,CTCF 10:13085505-13087386 TCCACACCTTCCCAGACACACCATGT +
Target
Locus2 Fragment location Primer sequence Strand
Plagl1,,3’UTR Out,last exon 10:13127101-13129234 GGGTGCACACCCCACAGGTGAG -

4.Reference

Iglesias-Platas, I., et al. (2013). "Imprinting at the PLAGL1 domain is contained within a 70-kb CTCF/cohesin-mediated non-allelic chromatin loop." Nucleic Acids Res 41(4): 2171-2179.   PMID: 23295672

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.