Detail Information of mm0000252 [Genome Browser]
1.Basic Information

Name: mm0000252
Species: Mus musculus
Cell Line: 3134 cells
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: absent in AtT20 cells; not dependent on the presence of hormone
Primer amount: NA
Test repetition: two
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Lcn2,glucocorticoid-responsive element 2:32385222-32389197 TTTACCTGTTTGCTGCTCCT +
Target
Locus2 Fragment location Primer sequence Strand
Ciz,-26 kb of Lcn2 GRE 2:32363704-32365185 TGAAAACAAACAAACAAATCCAAGCG +

4.Reference

Hakim, O., et al. (2009). "Glucocorticoid receptor activation of the Ciz1-Lcn2 locus by long range interactions." Journal of Biological Chemistry 284(10): 6048-6052.   PMID: 19124469

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.