Detail Information of mm0000236 [Genome Browser]
1.Basic Information

Name: mm0000236
Species: Mus musculus
Cell Line: B cells
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: WT and hs5–7KO
Primer amount: 7
Test repetition: two
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Igh,Eμ 12:113425850-113426615 CCTAAAGCAATGACTGAAGACTC +
Target
Locus2 Fragment location Primer sequence Strand
Igh,3'enhancers,hs3a 12:113252909-113255643 AGTGTTAGGTGTTGTCCTCGTCAT -

4.Reference

Volpi, S. A., et al. (2012). "Germline deletion of Igh 3' regulatory region elements hs 5, 6, 7 (hs5-7) affects B cell-specific regulation, rearrangement, and insulation of the Igh locus." J Immunol 188(6): 2556-2566.   PMID: 22345664

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.