Detail Information of mm0000225 [Genome Browser]
1.Basic Information

Name: mm0000225
Species: Mus musculus
Cell Line: C2C12
Restriction Enzyme: BamHI & BglII

2.Experiment Infromation

Remark: only on the paternal chromosome
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Nctc1,promoter 7:142557876-142563895 CTGTACCCGGAACAAGTTAGC -
Target
Locus2 Fragment location Primer sequence Strand
H19,promoter 7:142576442-142577456 ACAGAAGGGCAGTCATCCAG -

4.Reference

Eun, B., et al. (2013). "Promoter cross-talk via a shared enhancer explains paternally biased expression of Nctc1 at the Igf2/H19/Nctc1 imprinted locus." Nucleic Acids Res 41(2): 817-826.   PMID: 23221643

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.