Detail Information of mm0000218 [Genome Browser]
1.Basic Information

Name: mm0000218
Species: Mus musculus
Cell Line: liver cells
Restriction Enzyme: HaeIII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
H19,endodermal enhancer 7:142564954-142571581 AAAAGGGACTTCAGACCTTATGCCCCCCACCTACCAG -
Target
Locus2 Fragment location Primer sequence Strand
Igf2,placental promoter,segment 10 7:142671410-142675026 CAGTGATAACTTTAGATTGTGGATTGTAA -

4.Reference

Engel, N., et al. (2008). "Three-dimensional conformation at the H19/Igf2 locus supports a model of enhancer tracking." Hum Mol Genet 17(19): 3021-3029.   PMID: 18617529

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.