Detail Information of mm0000210 [Genome Browser]
1.Basic Information

Name: mm0000210
Species: Mus musculus
Cell Line: liver cells
Restriction Enzyme: NlaIII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
H19,endodermal enhancer 7:142571542-142571573 GTACAGGAGGCTCTACCCCCACCCTCCGTGTG -
Target
Locus2 Fragment location Primer sequence Strand
H19,segment 2 7:142584062-142586187 CATTAGAAGAGAACATTTAGACTCAGACAT -

4.Reference

Engel, N., et al. (2008). "Three-dimensional conformation at the H19/Igf2 locus supports a model of enhancer tracking." Hum Mol Genet 17(19): 3021-3029.   PMID: 18617529

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.