Detail Information of mm0000194 [Genome Browser]
1.Basic Information

Name: mm0000194
Species: Mus musculus
Cell Line: erythroid cells
Restriction Enzyme: MboI

2.Experiment Infromation

Remark: on the supplement without pic
Primer amount: 18
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Ercc3 (anchor) 18:32247177-32248302 CTGTCTCGTCCTGGGCAACT +
Target
Locus2 Fragment location Primer sequence Strand
Ercc3 (test) 18:32248449-32248989 CATTCCTAGAGATTTACAACCCTCAC +

4.Reference

Gavrilov, A. A., et al. (2013). "Disclosure of a structural milieu for the proximity ligation reveals the elusive nature of an active chromatin hub." Nucleic Acids Res 41(6): 3563-3575.   PMID: 23396278

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.