Detail Information of hs0000112 [Genome Browser]
1.Basic Information

Name: hs0000112
Species: Homo sapiens
Cell Line: K562
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: Reduction of CTCF, Rad21,SMC3 results in loss of CTCF site interactions
Primer amount: NA
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
HBB,segment C24,CTCF 11:5575217-5575652 TCTTTGTGCTTTTTGATAGAG -
Target
Locus2 Fragment location Primer sequence Strand
HBB,segment C26,CTCF 11:5622001-5631270 AAGCTCTGGCCCTGGTTC -

4.Reference

Hou, C., et al. (2010). "Cell type specificity of chromatin organization mediated by CTCF and cohesin." Proc Natl Acad Sci USA 107(8): 3651-3656.   PMID: 20133600

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.