Detail Information of mm0000176
1.Basic Information

Name: mm0000176
Species: Mus musculus
Cell Line: cardiomyocytes
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: expressing or lacking Nkx2-5
Primer amount: 7
Test repetition: two
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Nppa,promoter NA NA NA
Target
Locus2 Fragment location Primer sequence Strand
Nppa,-34kb segment 4:147965182-147966389 GACTGGATATGATGACGGAGCAT +

4.Reference

Warren, S. A., et al. (2011). "Differential role of Nkx2-5 in activation of the atrial natriuretic factor gene in the developing versus failing heart." Mol Cell Biol 31(22): 4633-4645.   PMID: 21930795

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.