Detail Information of mm0000171
1.Basic Information

Name: mm0000171
Species: Mus musculus
Cell Line: primary neurons
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: KCl depolarization induced an up-regulation of cross-linking frequencies,TTX exposure for 3 days down-regulated the interactions
Primer amount: NA
Test repetition: three
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Cox4i1 8:120669806-120670764 TCAGCAGGTAAGAGCACTGG -
Target
Locus2 Fragment location Primer sequence Strand
Cox8a NA NA NA

4.Reference

Dhar, S. S., et al. (2009). "Chromosome conformation capture of all 13 genomic Loci in the transcriptional regulation of the multisubunit bigenomic cytochrome C oxidase in neurons." Journal of Biological Chemistry 284(28): 18644-18650.   PMID: 19439416

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.