Detail Information of mm0000121 [Genome Browser]
1.Basic Information

Name: mm0000121
Species: Mus musculus
Cell Line: NA
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: conrol: negtive locus, no cross-linking, no ligase
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Calr,+2.8kb segment 8:84844072-84849195 F 5′TTCTTCTACAGGGCGAGTGG 3′;R 5′GACTTGAGGTCTGCCAGGAA 3′ -
Target
Locus2 Fragment location Primer sequence Strand
Calr,+4.4kb segment 8:84842522-84844077 F 5′CTGGCTGCTCCCAATAATGT 3′;R 5′GGGAGGGACAGAAGGAAAAG 3 -

4.Reference

Dhar, S. S. and M. T. Wong-Riley (2010). "Chromosome conformation capture of transcriptional interactions between cytochrome c oxidase genes and genes of glutamatergic synaptic transmission in neurons." Journal of Neurochemistry 115(3): 676-683.   PMID: 21064266

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.