Detail Information of mm0000117 [Genome Browser]
1.Basic Information

Name: mm0000117
Species: Mus musculus
Cell Line: liver cells
Restriction Enzyme: BamHI

2.Experiment Infromation

Remark: specific of the paternal chromosome; lost in the 30-days-old mouse liver
Primer amount: NA
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
H19,intergenic,segment 10 7:142628891-142630167 CTGTGACAGTGGTATGCACCAAG -
Target
Locus2 Fragment location Primer sequence Strand
Igf2,gene body,segment 17 7:142655801-142661345 AGCCTGCGTTTCTTTCTCCAGG -

4.Reference

Court, F., et al. (2011). "Long-range chromatin interactions at the mouse Igf2/H19 locus reveal a novel paternally expressed long non-coding RNA." Nucleic Acids Res 39(14): 5893-5906.   PMID: 21478171

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.