Detail Information of mm0000086 [Genome Browser]
1.Basic Information

Name: mm0000086
Species: Mus musculus
Cell Line: F9
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: control: BAC; retinoic acid (RA) treatment most interaction disappeared
Primer amount: NA
Test repetition: three
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Hoxc,segment primer12 15:102980860-102987682 TCTGCCCCTGGTCAGCTCAGTTTC -
Target
Locus2 Fragment location Primer sequence Strand
Hoxc,segment primer19 15:103012136-103013357 CTCCAGTCACATCCCAGAGAGTAC +

4.Reference

Lee, J. Y., et al. (2010). "Chromatin organization and transcriptional activation of Hox genes." Anat Cell Biol 43(1): 78-85.   PMID: 21190008

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.