Detail Information of hs0000010
1.Basic Information

Name: hs0000010
Species: Homo sapiens
Cell Line: HUVECs
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: treatment: VEGFA and required EP300 activity
Primer amount: NA
Test repetition: NA
Reliability Level: NA

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
CD34,promoter,E3F2 1:208083858-208088346 GGCATTTTGGATTTCAGATTTC +
Target
Locus2 Fragment location Primer sequence Strand
KDR,segment4 NA NA NA

4.Reference

Zhang, B., et al. (2013). "A dynamic H3K27ac signature identifies VEGFA-stimulated endothelial enhancers and requires EP300 activity." Genome Res 23(6): 917-927.   PMID: 23547170

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.