Browse Data
The Locus List of Species Oryctolagus cuniculus
Item  1    -  1   of 1 Data/Page  First Prev of 1 Next Last
  Name Anchor Target
Locus1 Fragment location Primer sequence Strand Locus2 Fragment location Primer sequence Strand
1 oc0000001 SMARCA3 chr14:42902098-42902127 CCCGATGAAGATTTTCCAAACTCGGTGTATC - SMARCA3,distal GC-rich site,-131/-126 segment chr14:42901569-42901591 CAGACGTCGTCGCCGTTTCCTTC +
©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.